Comprehensive Analysis and the Characterization of Multidrug Resistant (MDR) and Extended Spectrum Beta Lactamase (ESBL) Producing Bacteria Isolates in Clinical Samples from Some Hospitals in Asaba Delta State

Comprehensive Analysis and the Characterization of Multidrug Resistant (MDR) and Extended Spectrum Beta Lactamase (ESBL) Producing Bacteria Isolates in Clinical Samples from Some Hospitals in Asaba Delta State

 

Glory Ewere CHUKWUKA (PhD)

Department of Biological Sciences, Microbiology Unit

Faculty of Sciences

University of Delta, Agbor, Delta State, Nigeria

glory.chukwuka@unidel.edu.ng

 

ABSTRACT

This study looked at the bacterial isolates that produced extended spectrum β-lactamase (ESBL) and were multidrug resistant (MDR) in clinical samples from the Federal Medical Center in Asaba. Between November 2018 and January 2019, 32 pure cultures of isolates from wound swabs, urine, feces, high vaginal swabs (HVS), and ear swabs were collected from the hospitals (with patient agreement). The isolates were tested for ESBL production using the double-disc synergy test and were presumed to be identified using normal culture and biochemical procedures. 16S rRNA partial sequence analysis was used to molecularly validate the identities of the chosen isolates. The disk diffusion technique, as outlined by the Clinical and Laboratory Standard Institute, was used to assess and interpret the antibiogram of a subset of isolates. Ten out of thirty-two (31%) isolates showed MDR characteristics, and four (12.5%) of them produced ESBLs, according to the study. Staphylococcus caprae ATCC 35538, Staphylococcus sciuri subsp. rodentium, JCM 1689 strain of Escherichia coli, LMG 2693 strain of Enterobacter cancerogenus, Proteus mirabilis ATCC 29906, Esherichia fergusonii ATCC 35469 (ESBL producer), and Shigella sonnei strain CECT 4887 were among the isolates. The isolates' profile of antibiotic susceptibility revealed that, while they were highly resistant to ceftazidime (100%), oxacillin (100%), cefotaxime (100%), tetracycline (80%), ceftazidime/clavulanate (70%), and cefotaxime/clavulanate (70%), the organisms were highly susceptible to imipenem (100%), vancomycin (80%), and netilimicin (70%). The study showed that clinical samples taken from hospitals in Benin City, Nigeria, have a notable incidence of bacterial strains that produce MDR/ESBL. So, in order to stop the spread of multidrug resistant bacteria in Nigeria and elsewhere, stakeholders must implement efficient hospital-based infection prevention/control and antibiotic stewardship programs.

Keywords: Multidrug Resistant (MDR), Extended Spectrum Beta Lactamase (ESBL), Bacteria Isolates in Clinical Samples, 16S rRNA, Escherichia coli, Enterobacter cancerogenus, Esherichia fergusonii

 

 

 

 

 

INTRODUCTION

ESBLs are enzymes that can hydrolyze penicillins, monobactam, and extended spectrum cephalosporins, however they are not effective against imipenem and cephamycin (Coyle, 2005). Cefuroxime, cefotaxime, ceftazidime, and ceftriaxone are examples of oxyimino- (2nd and third generation) cephalosporins that they hydrolyze and give resistance to (Coyle, 2005). According to Perez and Hansoni (2002), they are primarily found in Enterobacteriaceae (e.g., E. coli, Klebsiella species, and Enterobacter species) and infrequently in non-fermenters like P. aeruginosa. Hospital facilities have reported isolates of ESBL-producing bacteria from clinical samples (Tumbarello et al., 2010; Turner, 2015). These isolates are said to significantly contribute to multidrug resistance, which causes treatment failures, lost productive man hours, delayed patient recovery, and high financial burden (Tumbarello et al., 2010; Pitout et al., 2010 Kluytmans et al., 2017). According to Pitout et al. (2010), infections caused by ESBL producers can range from simple UTIs to potentially fatal sepsis. Additionally, plasmids make it simple to transfer the genes encoding the enzyme from one organism to another (Turner, 2015). As a result, ESBL-containing organisms, which were previously mostly found in hospital settings, are now rather frequent in infections acquired in the community (Livermore and Brown, 2001).

 

Numerous outbreaks of infections due to ESBL‑producing bacteria have been reported on every continent of the globe and pose challenging infection control issues (Turner, 2015). Some initial outbreaks of infection have been supplanted by endemicity leading to increased patient morbidity and mortality (Nathisuwan et al., 2001; Paterson and Bonomo, 2005; Knudsen and Andersen, 2014). In Nigeria, cephalosporins which are widely used as broad spectrum antibiotics and drugs of choice to treat many infections are reported to be increasingly ineffective against ESBL producing bacteria pathogens (Ogefere et al., 2015). The prevalence rates of infections due to ESBL producers in Nigeria ranged from 5% to 44.3% in Ogun State, Kano, Nnewi, Maiduguri, Zaria, and Benin City (Olonitola et al., 2007; Akujobi and Ewuru, 2010; Olowe and Aboderin 2010; Yusha’u et al.,  2010; Ogefere et al., 2015; Mohammed et al., 2016). Although Ogefere et al. (2015) reported several ESBL producing bacteria in wound and urinary specimen from a single hospital in Benin City, there is dearth of information on the prevalence of such bacterial strains across hospital facilities in the ancient City. Moreover, the authors did not identify strains of the ESBL producers using the more reliable molecular techniques. Hence, it became imperative to expand the surveillance for ESBL producing bacteria strains in Benin City beyond a single hospital and ensure that isolated strains were identified using molecular techniques.

 

2.0 LITERATURE REVIEW

2.1       Multi-drug resistance

Multi-Drug Resistance (MDR) refers to the phenomenon where microorganisms, particularly bacteria, fungi, and cancer cells, develop resistance to multiple drugs that are typically effective against them. This resistance poses significant challenges in treating infections and diseases, leading to increased morbidity and mortality (WHO, 2014). An estimated 100,000 tons of antibiotics are produced globally each year, and their use has had a significant impact on bacterial life (Nikaido, 2016). One of the biggest threats to global public health in the twenty-first century is antimicrobial resistance, or AMR (WHO, 2014). According to Pfeiffer et al. (2015), there is an increasing number of drug-resistant microbial strains, drug-resistant regions, and the degree of resistance in various organisms. Multidrug resistance is the term used to describe the rise in pathogen strains that are resistant to multiple antibiotics and chemotherapeutic drugs (De Lemcastre et al., 2007). Certain bacterial strains have developed resistance to almost all of the widely used medications. Moreover, the percentages of organisms exhibiting AMR, especially resistance to multiple antibiotics, are on the increase (Noor and Munna, 2015). Thus, disease agents that were once thought to be susceptible to antibiotics are returning in new leagues resistant to these therapeutic agents (Levy, 2010). Multidrug resistance in bacteria occurs by the acquisition of resistance (R) plasmids, transposons, or genes, which code for resistance to a specific agent; and/or by the action of multidrug efflux pumps, each of which can pump out more than one drug type (Hooper, 2005).

 

2.2       Beta-Lactam (β-Lactam) Antibiotics

β-lactam antibiotics are among the most commonly prescribed drugs and are composed of an isolated ring (monobactam), or associated with bicyclic ring structures in other classes such as penams, penems and cephems (Pfeiffer et al., 2015). Overall side chain modifications within groups alter the pharmacokinetic and antibacterial properties of different β–lactam antibiotics. For example, modifications of the 7^th carbon chain of cephalosporins increases the penetration into the periplasmic space and stability against β-lactamases, but may reduce antibiotics efficacy (Gupta et al., 2015). β-lactam antibiotics are indicated for the prophylaxis and treatment of bacterial infections caused by susceptible organisms (Pfeiffer et al., 2015). They range from very narrow spectrum to very broad spectrum depending on the subgroups, with the broadest spectrum (third and fourth generation cephalosporins) having the ability to inactivate both Gram-negative and Gram-positive bacteria (Murray et al., 2005).

 

2.2.1    Mechanism of Action of β-lactam Antibiotics

Most β-lactam antibiotics work by inhibiting the biosynthesis of bacteria cell wall. Bacteria often develop resistance to β-lactam antibiotics by synthesizing β-lactamase, an enzyme that attacks the β-lactam ring (Asensio et al., 2000). To overcome this resistance, β-lactam antibiotics are often given with β-lactamase inhibitors such as clavulanic acid (Williamson et al., 2013). The mode of action of beta-lactam antibiotics, and the non-enzymatic resistance mechanisms to their activity are intimately linked to the structure and biosynthesis of the bacterial cell wall (Williamson et al., 2013). The bacteriostatic effect of β-lactam antibiotics is related to their various interactions and concomitant inhibition of essential enzymes (transpeptidase, carboxypeptidase) involved in the terminal stages of peptidoglycan biosynthesis (Semenitz, 2015). These cytoplasmic membrane-associated target enzymes bind the antibiotics covalently, and hence are known as penicillin-binding proteins (PBPs) (Williamson et al., 2013). The bactericidal effect of these antibiotics is due to a second step following the inhibition of cell division and growth, in which the activation of an autolytic system causes cell death (Williamson et al., 2013).

 

β-lactam antibiotics also influence the metabolism of bacteria in very low concentrations by blocking the activity of PBPs in Gram-negative bacteria (Semenitz, 2015). Depending on the type of binding protein affected, bacteria would usually form filaments or sphaeroblasts (Williamson et al., 2013). The most important resistance mechanism however, is the formation of β- lactamase, which cleaves the β-lactam ring and inactivate the antimicrobially active molecule (Steward et al., 2001). In Gram-negative bacteria, the β-lactamases are formed in the periplasmic space and inactivates the antibiotics after penetrating the bacterial cell (Semenitz, 2015).

 

2.3.1 ESBL Epidemiology

These strains have been reported in different regions of the world since the identification of ESBL-producing isolates in Europe in the 1980s (Knothe et al., 1983; Steward et al., 2001; Paterson et al., 2005; Cosgrove et al., 2006). According to Philippon et al. (2002), Escherichia coli, Klebsiella pneumoniae, and Klebsiella oxytoca are the primary hosts of ESBLs. Additionally, according to Patterson et al. (2005), they have been isolated from Enterobacter species, Salmonella enterica, Morganella morganii, Proteus mirabilis, Serratia marcescens, and Pseudomonas aeruginosa. According to Asensio et al. (2000), individuals who have been exposed to high/long levels of antibiotic use, particularly the use of third-generation cephalosporins and aminoglycosides, and those who are ill and need to use medical devices like catheters are more likely to become infected with ESBL-producing organisms.  Although treatment failures have been reported, organisms that generate ESBLs usually maintain their in vitro sensitivity to cefoxitin, cefotetan, and carbapenems (Bonomo et al., 1997; Gupta, 2007). Infections caused by ESBL-producing organisms have been linked in a number of studies, the majority involving adult patients, to greater treatment failure, higher mortality, longer hospital admissions, and higher health care expenses (Goossens, 2009). Despite the existence of population-based estimates of the frequency and incidence of this burden, the ranges of these estimates are quite broad, ranging from 6% to 70%, depending on the continent and even the center (Pakyz et al., 2008). Some of the risk factors that have been identified for the acquisition of infections with ESBL-producing organisms in adults include prolonged hospital stays, prolonged stays in intensive care units (ICUs), living in long-term care facilities, recent exposure to multiple antibiotics (particularly third-generation cephalosporins), and indwelling invasive devices(Pfaller and Segreti, 2006).

2.3.2 The prevalence of bacteria that produce ESBL in Nigeria

Raji et al. (2013) found that of the 102 isolates examined in a point-surveillance investigation of antibiotic resistance among enterobacteriaceae isolates from patients in a Lagos Teaching Hospital, Nigeria, 43 (42.2%) were Escherichia coli and 32 (31.4%) were Klebsiella pneumoniae. With the exception of carbapenems and piperacillin—tazobactam—these isolates showed remarkably high rates of resistance to beta-lactam antibiotics. Of them, fifty-two (51%) were resistant to three drug classes, 29 (28.4%) to five drug classes, and thirty-eight (37.3%) produced ESBL. Of them, 12 (31.6%) were K. pneumoniae and 21 (55.3%) were E. Coli. Yusuf (2013) stated that in a different investigation conducted in a tertiary care teaching hospital in Kano, Nigeria, they detected 75 ESBL producers, of which 50% were Shigella spp. The other ESBL generating species identified were E. coli and Klebsiella pneumoniae. There have also been reports of ESBL production from other members of the enterobacteriaceae family, including Proteus and Enterobacter species (Akujobi and Ewuru, 2010). In Ogun State, Kano, Nnewi, Maiduguri, Zaria, and Benin City, the prevalence rates of infections caused by ESBL producers varied from 5% to 44.3% (Olonitola et al., 2007; Akujobi and Ewuru, 2010; Olowe and Aboderin 2010; Yusha’u et al., 2010; Ogefere et al., 2015; Mohammed et al., 2016). Enterobacteriaceae (2.4) Gram-negative bacteria belong to the broad family Enterobacteriaceae. According to Yusha'u et al. (2011), this family is the sole representative of the class Gammaproteobacteria in the phylum Proteobacteria's order Enterobacteriales. Yersinia pestis, Shigella, Salmonella, Escherichia coli, Klebsiella, and many more well-known pathogens are within the Enterobacteriaceae family of bacteria, along with a large number of benign symbionts. Proteus, Enterobacter, Serratia, and Citrobacter are further disease-causing bacteria in this family (Yusha'u et al., 2011). Since many of these organisms are found in animal intestines, they are frequently referred to as enterobacteria or "enteric bacteria" (Yong et al., 2009).

 

2.4.2 Enterobacteriaceae's Resistance to Antibiotics

According to Pfeiffer et al. (2010), a number of enterobacteriaceae have been recovered from clinical specimens, and the majority of them are resistant to conventional antibiotics. The prevalence of multidrug resistance to routinely used antibiotics is increasing in clinical isolates of Enterobacteriaceae. These bacteria produce AmpC-type β-lactamase or extended-spectrum β-lactamase (ESBL), which results in resistance to most β-lactam antibiotics and is frequently linked to resistance to fluoroquinolones and aminoglycosides (Castanheira et al., 2015). A class of antibiotics known as β-lactams works on a bacterial cell's cell wall. Penicillins, cephalosporins, carbapenems, and monobactems are a few of them. These antibiotics block the carboxypeptidases and transpeptidases and prevent their release by attaching to the enzymes that synthesize cell walls, commonly known as penicillin-binding proteins, or PBPs. According to Castanheira et al. (2015), the enzymes also catalyze the D-ala-D-ala cross links of the peptidoglycan wall that envelops the bacterium. This weakens the structure of the cell wall and causes cell lysis. Although resistance to β-lactam antibiotics has likely existed throughout the history of bacteria, it has evolved into a desirable feature that is thus chosen for since the drugs' introduction into clinical use. According to Yusha'u et al. (2011), these medications effected Darwinian selection, eliminating vulnerable bacteria while permitting the resistant ones to endure.

 

Many serious, sometimes fatal infections are caused by the enterobacteriaceae family, and resistance to many antibiotics in these organisms is becoming a growing worldwide public health concern (WHO, 2015). Antibiotic resistance can result from chromosomal gene mutations, but enterobacteriaceae are suited to exchanging genetic material, therefore "mobile" resistance genes account for a large portion of resistance (Pakyz et al., 2008). These genes are taken from the chromosomes of different species of bacteria and transferred between DNA molecules by distinct mobile genetic components, each of which has its own attributes. These resistance genes, if inserted onto plasmids, might be passed both "vertically" during cell division and "horizontally" across other bacterial cells, including different species (Castanheira et al., 2015). A bacterial cell can acquire multi-resistance in a single step when many resistance genes are carried on the same plasmid. This also implies that the expansion of a single resistance gene may be co-selected for by using antibiotics other than those to which it imparts resistance (Goossens, 2009).

 

According to Castanheira et al. (2015), there are four primary types of enterobacteriaceae antimicrobial resistance mechanisms: (1) lowering drug absorption by decreasing the permeability of the outer cell membrane; (2) altering a drug target; (3) inactivating a drug; or (4) active drug efflux.
Nonetheless, the most prevalent bacterial mechanisms behind intrinsic resistance are the inherent efflux pump activity and the decreased permeability of the outer membrane, particularly with regard to lipopolysaccharide (Cox and Wright, 2013).

 

2.5 Types of Staphylococci

Numerous types of infections are known to be caused by staphylococci. Among the several illnesses brought on by staphylococci include boils, styes, localized abscesses, osteomyelitis, endocarditis, and furunculosis (Gorwitz, 2008). The most well-known member of the genus, S aureus, together with S epidermidis, is responsible for hospital-acquired (nosocomial) infections of surgical wounds and infections related to indwelling medical devices (Walsh, 2016). The coagulase test makes differentiating between Staphylococcus species simple. Certain staphylococci are coagulase negative, however S aureus and S intermedi are coagulase positive (Gorwitz, 2008). They are frequently hemolytic and can withstand salt. Most staphylococci are harmful; they release toxins that harm the tissues of their hosts (Foster, 2017).

 

2.5.1 Caprae Staphylococcus

According to Seng et al. (2014), Staphylococuscaprae is a Gram-positive coccus belonging to the Staphylococcus genus. Coagulase is not present in S. caprae. Although the Latin word "caprae" means "of a goat," this species was first isolated from goats, but it has also been recovered from human samples (Carretto et al., 2005). Because S. caprae is commensal on human skin and has also been linked to infections of the circulation, urinary system, bones, and joints, it is significant from a clinical standpoint (Seng et al., 2014). The incidence of S. caprae in people is underreported because the species is challenging to identify with certainty in the laboratory (Seng et al., 2014). Devisee et al. (1983) initially described Staphylococcus caprae using a strain that was obtained from some goat milk. It is thought to be a commensal organism for goat skin mammary glands and can occasionally induce mastitis in the animals (Seng et al., 2014). According to reports, it is a pathogen that people get in hospitals, primarily from diseases of the bones and joints (Ersu et al., 2016). Studies on S. caprae producing sepsis in a clinical environment have been conducted (Ersu et al., 2016).

2.5.2 Sciuri by Staphylococcus

This pathogen is opportunistic and has a debatable clinical importance. It belongs to the bacterial genus Staphylococcus and is a Gram-positive, oxidase-positive, coagulase-negative member that consists of clustered cocci. Originally, 35 strains that were found to consume cellobiose, galactose, sucrose, and glycerol were classified under the type subspecies S. sciuri (Nemeghaire et al. 2014).
Catalase-positive, coagulase-negative Staphylococcus caprae and Staphylococus sciuri belong to the class of bacteria known as coagulase-negative Staphylococcus (CoNS). While these species are regularly found in clinical specimens as contaminants and are acknowledged as components of the healthy human skin flora, they are generally not thought to have the same pathogenic potential as coagulase-positive Staphylococcus aureus. The capacity of CoNS species to form biofilm and colonize biomaterials is thought to be responsible for their virulent characteristics (Gowda et al., 2018; Becker et al., 2014). As a result, CoNS infections frequently have antibiotic resistance across a wide range of classes. It has been documented that S. caprae and S. sciuri can cause invasive infections in some susceptible patient populations, such as those with indwelling medical devices, immunocompromised patients, and premature neonates (Gowda et al., 2018). Numerous risk factors, including as immunosuppression, diabetes, chronic renal failure, obesity, open or traumatic fractures, and contact with sheep or goats, have started to emerge for both species of Staphylococcus (Behme et al., 1997; Kato et al., 2010). Significantly, a number of strains of these species have been reported to produce the toxic shock syndrome toxin and to carry the mecA gene, which is essential for methicillin resistance. They have also been reported to form biofilm on prosthetics or bone in vitro, which is thought to be caused by the combination of the ica operon and the gene altC (Gowda et al., 2018).

2.5.3 Staphylococcus species and antibiotic resistance

The propensity of Staphylococcus species to develop antibiotic resistance is well-known. Horizontal gene transfer from external sources is a common way for resistance to spread, whereas chromosomal mutation and antibiotic selection also play significant roles (Walsh, 2016). Additionally, endogenous efflux pump production can increase resistance, as can mutations that change the molecular targets' drug binding sites (Foster, 2017). In theory, it is possible to prevent the emergence of resistance through mutation by combining inhibitors that target distinct locations or by requiring two or more mutations in order for resistance to cross the MIC breakpoint (Gorwitz, 2008). Up to six distinct gene changes are needed to develop resistance to vancomycin, which causes the cell envelope to change and restricts the drug's ability to reach the deadly target (Gorwitz, 2008).
PBP2, a bifunctional transglycosylase-transpeptidase, is the primary target of β-lactam antibiotics in Staphylococcus species. (Walsh, 2016). The disaccharide pentapeptide building block of peptidoglycan is transferred from membrane-bound lipid II to expanding polysaccharide chains by the enzyme's transglycosylase domain, whereas the transpeptidase (TP) domain cross-links the glycine cross-bridge of a neighboring chain's fourth D-alanine (Foster, 2017). Worldwide, infections brought on by Staphylococcus strains resistant to antibiotics assume pandemic proportions (Walsh, 2016).

3. MATERIALS AND METHODS

 

SAMPLE COLLECTIONS

Between November 2018 and January 2019, a total of thirty-two (32) clinical isolates were obtained from Federal Medical Centre Asaba.  Nine from wound swabs, eight from urine, six from stool, five from high vaginal swabs (HVS), and four from ear swabs comprised the 32 isolates. With the patients' permission, the isolates were acquired by culture of the aforementioned specimens. The source, age, and sex of the subject were appropriately labeled on the collected isolates, which were then sent within 24 hours to Benson Idahosa University's Microbiology Laboratory for bacteriological investigation. The isolated samples were collected, subcultured, and then incubated for 24 hours at 37 °C on nutrient agar plates. For additional examination, pure cultures of the isolates were kept on nutrient agar slants at 4 oC.

 

3.2 Examining Isolates for ESBL Production

The first screening of ESBL production among test isolates was conducted using the double disk synergy test (Sahraoui et al., 2016). The goal of the test was to determine the synergistic relationship between a C3 (ceftriaxone, ceftazidime, and cefotaxime) antibiotic disc and an antibiotic disk containing a β-lactamases inhibitor (amoxicillin/clavunalate). Figure 3.1's synergy picture, which resembles a champagne cork, is indicative of the relevant test isolate's ESBL production. A 24-hour culture of the test organisms was seeded onto Mueller-Hinton agar, and an amoxicillin-clavulanate disk containing ceftriaxone, ceftazidime, and cefotaxime was positioned 20 mm from center to center. The culture was kept at 35 °C for 18 to 24 hours. The antibiotic's inhibition zone has a distinct extension edge.

Plate 3.1. Champagne cork image of ESBL producing bacteria on agar plate

toward the disk containing clavulanic acid (champagne cork image) was interpreted as synergy, indicating the production of ESBL phenotype by the isolate. The above procedure was used to screen the 32 isolates for ESBL production.

3.3       ESBL Phenotype Confirmation

The double disc synergy test involving the use of a single cephalosporin (ceftazidime, cefotaxime and ceftriaxone) together with a β-lactamase inhibitor in combination with a cephalosporin (ceftazidime/clavunalate and cefotaxime/clavunalate) was employed in the confirmation of ESBL production among test isolates (Nahla et al. 2018). The antibiotics were supplied by Mast group, Merseyside, United Kingdom. Mueller–Hinton agar (Oxoid Ltd., Hampshire, England) inoculated with a suspension of the test isolate (0.5 McFarland turbidity) was impregnated with the single cephalosporin placed 30 mm apart from its corresponding clavulanate combination (e.g. ceftazidime placed 30 mm apart from clavunalate/ceftazidime). Extension of the edge of the inhibition zone by > 5 mm in the combination antibiotics compared to its corresponding single drug was interpreted as confirmation of ESBL production by the test isolate (Nahla et al. 2018). Isolates were further subjected to general antibiogramic assay using other relevant antibiotics.

 

 

3.4       Presumptive Identification of Bacterial Isolates

The selected bacterial isolates were presumptively characterized using Gram stain reaction, their cultural (motility) and biochemical characteristics(urease, Hydrogen sulphide test, oxidase, indole, citrate and sugar fermentation) (Nahla et al., 2018).

3.4.1    Gram Staining

Gram staining was carried out to differentiate Gram positive from Gram negative bacteria. A drop of distill`ed water was placed on a clean grease-free microscopic slide and a smear was made by collecting an inoculum of the test organism (using a wireloop) and mixing it with the drop of water. The smear was allowed to air dry and then fixed by gently passing it through a Bunsen burner flame two or three times. The smear was flooded with crystal violet and rinsed with water after 60 secs. Iodine which serves as a mordant was applied to the smear and then rinsed with water after 60 secs; the stained smear was then decolorized with acetone and rinsed immediately with water. The smear was then flooded with safranin (a counter stain) for 45 secs and rinsed with water. The slides were allowed to air dry; and a drop of immersion oil placed on the smear before viewing under the light microscope using
×100 objective lens. Gram positive isolates retained the primary stain (crystal violet) and appeared purple, while the Gram-negative ones took up the secondary stain (safranin) and appeared pink or red.

 3.4.2  Motility

This was done by the stab culture technique. The isolates were inoculated into semi solid nutrient agar medium in test tubes by making a straight line stab up to about the middle of the medium. The cultures were incubated at 37°C for 18-24 h. The tubes were examined for growth. Growth along the line of stab indicated negative result (non-motile organism), while concentration of growth at the top of the tube or turbidity of the entire medium indicated positive result for motility.

3.4.3    Oxidase Test

This test was used to identify bacteria which have the ability to produce the enzyme cytochrome oxidase. It indicates the ability of microbes to oxidize amines. Twenty four-hour culture of each of the bacterial isolates were smeared on a clean filter paper using sterile wire loop. A drop of oxidase reagent (1.0% aqueous tetramethyl- phenylenediarnine dihydrochloride) was added. A positive test was indicated by a deep purple colouration after few seconds suggesting the presence of the enzyme (oxidase), while absence of colouration indicated a negative test.

3.4.4   Citrate Test

This test was used to determine if the test organisms were able to utilize citrate as their sole source of carbon and energy for growth. Simmons citrate agar was boiled for 5 mins; 6ml was dispensed into test tubes and autoclaved for 15 mins at 121 psi. The media was allowed to cool, solidify and inoculated with the test organisms. The culture was incubated at 37^oC for 24 - 48 hrs. Change in colour from green to blue indicated a positive result; no change in colour indicated a negative result.

3.4.5   Indole Test

Indole test is used to determine the ability of an organism to split the amino acid tryptophan to form the compound indole.  Sterilized test tubes containing 4 ml of tryptophan broth was inoculated aseptically with 18 to 24-hr culture of test isolate. The tube was incubated at 37°C for 24-28 hrs after which 0.5 ml of Kovac’s reagent was added to the broth culture. Formation of a pink to red colour in the medium within seconds of adding the reagent indicated a positive result. a negative reaction is indicated by no change in colour after addition of Kovac’s reagent

3.4.6.  Urease Test

Urea is the product of decarboxylation of amino acids. Hydrolysis of urea produces ammonia and CO₂. The formation of ammonia alkalinizes the medium, and the pH shift is detected by the colour change of phenol red from light orange at pH 6.8 to magenta (pink) at pH 8.1.

The surface of the agar slant containing urease medium was inoculated with a loopful of pure culture of the test organism. The cap was left on loosely and incubated at 35^oC aerobically for 18-24 hrs. Phenol red was used as indicator. Colour change of the slant from orange to magenta indicated that the organism produced urease; while no change in colour or yellowish colour was an indication of a urease negative reaction.

 3.4.7   Hydrogen Sulphide (H₂S) Test

Hydrogen sulphide production was detected by incorporating a salt containing iron or lead as H₂S indicator to Sulphite Indole Motility (SIM) medium containing cystine and sodium thiosulfates as the sulfur substrates.  The organisms were stab inoculated and incubated at 37°C for 24-48 hrs. Hydrogen sulphide, a colorless gas, if produced reacts with the metal salt forming visible insoluble black precipitate of ferrous sulphide. Hence, A positive test showed black precipitate on top of the medium.

3.4.8   Triple Sugar Iron (TSI) Test

TSI Agar slant was inoculated with the test organism by first stabbing through the centre of the medium to the bottom of the tube and then streaking on the surface of the slant. The cap was left on loosely and the test tube incubated at 35°C for 18 to 24 h. A red slant/yellow butt (alkaline/acid) observation indicated dextrose fermentation only; yellow slant/yellow butt (acid/acid) indicated the fermentation of dextrose, lactose and/or sucrose; and observation of red slant/red butt (alkaline/alkaline) indicated an absence of carbohydrate fermentation. Bubbles or cracks in the medium indicated production of gas.

3.4.9    Sugar Fermentation Test

Each of the isolates were tested for their ability to ferment a given sugar with the production of acid and or gas. Peptone water was prepared in a conical flask using phenol red as the indicator and dispensed in 10 mls into test tubes containing inverted Durham tubes. The tubes with their content were sterilized by autoclaving at 121°C for 15 mins. One percent solution of the sugars (glucose, lactose, sucrose), was prepared and sterilized separately at 115°C for 10 mins. This was then aseptically dispensed in 5ml volume into the tubes containing peptone water and indicator. The tubes were inoculated with 24 hr culture of the isolates and incubated at 37^oC. Acid and or gas production was observed after about 24 hr incubation. Acid production was indicated by the change of the medium from red to yellow; while gas production was indicated by the presence of gas in the Durham tubes. No colour change is recorded as negative observation.

3.5   Antibiotics Susceptibility Testing

The antibiotics susceptibility test was done using standard disc diffusion method as described by the Clinical and Laboratory Standard Institute (CLSI, 2011). The following antibiotics: tetracycline (30µg), oxacillin (1µg), gentamicin (10µg), ciprofloxacin (5µg), vancomycin (5µg), ofloxacin (5µg) netilmicin (30µg), and imipenem (10µg) were used.  The inhibition zone diameters were recorded and interpreted according to the description of CLSI (2011).

3.6 Determination of Multiple Antibiotic Resistance (MAR) Index

The multiple antibiotic resistance index of the selected bacterial isolates was evaluated using a formula described by Odjadjare et al. (2012) as described below:

MAR = A/B

Where;

A = number of antibiotics to which the isolate was resistant

B = total number of antibiotics to which the isolate was exposed

3.7     Molecular Identification of Bacterial Isolates

3.7.1   Isolation and Purification of DNA

Genomic DNA extraction and purification from the test organisms was done using the Zymo Fungal/Bacterial DNA extraction kits (Zymo Research Corporation, CA, USA) according to the manufacturer's instruction, about 50-100mg (weight) of bacterial cells were re-suspended in 200µl of DNAase free water and placed in a ZR bashing bead ™ lysis tube, following which 750µl of lysis solution was added to the tube. The tube was further agitated at a maximum speed for 5 mins in a vortex mixer (Fisher Scientific, USA). The ZR bashing bead lysis tube was then centrifuged in a micro- centrifuge at 10,000 × g for 1 min. Four hundred microliter (400µl) of the supernatant was transferred to a zymo- spin IV spin filter in a collection tube and then centrifuged at 7,000 × g for 1 min. Afterwards 1,200µl of bacterial DNA binding buffer was added to the filtrate in the collection tube; 800µl of the mixture was then transferred to a zymo-spin IIC column in a collection tube and centrifuged at 10,000 × g for 1 min. The flow through was discarded and the process repeated. Two hundred microliter (200µl) of pre-wash buffer was added to the Zymo-spin ™ lIC column and centrifuged at 10, 000 × g for 1 min. About 500µl of the bacterial DNA wash buffer was added to the Zymo-Spin ™ IIC column and centrifuged at 10, 000 × g for 1 min. The Zymo-Spin ™ IIC column was then transferred to a clean 1.5 ml microcentrifuge tube and 100µl DNA elution buffer was added directly to the column matrix. This was centrifuged at 10,000 × g for 30 secs to elute the DNA. At this point the pure DNA is ready for use.

3.7.2    Amplification of 16S rRNA Gene

The amplification reactions of template genomic DNA from the test isolates was carried out in single 0.2 mL PCR tubes (Diamed, Lab Supplies, Ontario, Canada)) using a thermocycler. Each PCR reaction consisted of 5.0µl of 10× buffer (No MgCl₂, 10mM Tris-HCI, and 50 mM KCI), 2.5µl of MgCl₂ (50mM), l.0µl dNTPs (5mM each), 1.25µl of glycerol (80%) (Sigma), 4.0µl of bovine serum albumin (BSA) (10mg/ml) (Sigma), 5pMol/µl of each primer HDA-l GC (Primer length 60) with the sequence (5' to 3'); CGCCCGGGGCGC GCCCCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAG, and HDA-2 (Primer length 21) with the sequence (5' to 3'); GTA TA CCG CGG CTG CTGGCAT, (Invitrogen^TM Life Technologies, USA), 0.2µl of Platinum® Taq DNA polymerase (5U/µl) (Invitrogen^TM, Life Technologies, USA), 2.0µl of the template DNA, while nuclease free water was used to make the final volume 50µl. The PCR amplification condition involved an initial DNA denaturation at 94°C for 5 mins, followed by 36 cycles of denaturation at 94°C for 30 secs, annealing at 56°C for 30 secs and elongation at 72°C for 45 secs, which was followed by a final extension at 72°C for 7 mins. To confirm amplicon production, the PCR product was mixed with 2µl of loading dye and analyzed by electrophoresis (Bio-Rad, USA) using 1.5% Ultrapure^TM Agarose (Invitrogen^TM, Life Technologies, USA ) pre-stained with 1% ethidium bromide. Gels were separated at 100 volts for 45 mins, in an electrophoresis machine, following which they were visualized by a UV transilluminator and documented with Polaroid 667 instant film.

3.7.3    Sequencing the 16S rRNA Amplicon

The BigDye® Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA USA) method was used to sequence the 16S rRNA PCR product according to manufacturer's instruction.

3.7.4    Blast Analysis

The blast analysis was done on the National Centre for Biotechnology Information (NCBI) website (http://blast.ncbLnlm.nih.gov/). DNA sequences of each of the test organism was copied in fasta format into the nucleotide sequence search engine and used to query the NCBI data base in search of sequences producing significant alignments with a view to determining the best fit identity of each of the test organisms. The 16S rRNA partial sequence of the test isolates were submitted to GenBank (NCBI) with receipt of corresponding GenBank ascension numbers.

  RESULTS

4.1. Screening for ESBL Producing Isolates

Table 4.1 shows the results of screening for ESBL production among isolates. Out of the 32 clinical isolates, four (4) (12.5%) were confirmed as ESBL producers. The other six (6) isolates were selected for further analysis based on their high MDR phenotype especially against ceftazidime, cefotaxime ceftazidime/clavulanate, and cefotaxime/clavulanate during the ESBL screening.

4.2. Presumptive Identity of Isolates.

The ten (10) isolates were presumptively identified as Staphylococcus spp. (FMH, FMB, SOH(A)D), Escherichia spp. (FMR, UBTHC), Enterobacter sp. (FMN), Shigella spp. (FMJ, SOH(F) 308, SOH(B) 299)and Proteus sp. (SOH(E)316) (Table 4.2).

4.3   PCR Amplicon of Selected Isolates

The results of PCR amplicon of selected isolates are presented in figure 4.1.

4.4. Identity of Isolates using 16S rRNA Sequence Analysis

The isolates' identities as confirmed by 16S rRNA partial sequence analysis are as shown in Table 4.3. The isolates included Staphylococcus
caprae strain
ATCC 35538 (FMB; MDR/ESBL producer), Staphylococcus capraestrain
ATCC 35538 (SOH[A]D; MDR), Shigella sonnei strain CECT 4887 (FMJ; MDR), Enterobacter cancerogenus strain LMG 2693 (FMN; MDR), Escherichia coli strainJCM 1689 (FMR; MDR), Shigella flexneri stain ATCC 29903 (SOH[F]308; MDR/ESBL Producer), Shigella flexneri stain ATCC 29903 (SOH [B] 299; MDR), Proteus mirabilis stain ATCC 29906 (SOH [E]316; MDR), Staphylococcus sciuri subsp. rodentiumstrain GTC844 (FMH; MDR/ESBL Producer) and Escherichia fergusonii ATCC 35469 (UBTHC; MDR/ESBL Producer). Percentage identity of the isolates ranged between 93.48 and 99.75 as indicated in Table 4.3. 

Table 4.1: Results of screening for ESBL producing isolates

S/N	Isolate code	ESBL PRODUCTION
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32	FMA FMK SOH (E) 316* FMI FMG SOHE (310) FME UBTH (A) FMO FMR* FMB* FMH* FMU SOH (F) 308* FMN* FMS FML FMQ FMV FMP SOHC(309) UBTHD FMF SOHD(310) FMD FMM FMJ* SOH (A)D* SOH (B) 299* UBTHC* FMT UBTHB	- - - - - - - - - - + + - + - - - - - - - - - - - - - - - + - -

Key:  + = ESBL positive,       - = ESBL negative                  *Isolates that showed MDR and high resistance to ceftazidime, cefotaxime ceftazidime/clavulanate, and cefotaxime/clavulanate during ESBL screening.

Table 4.2: Phenotypic characteristics of the selected isolates

Isolate Code

Gram Reaction

Citrate

Motility

Oxidase Reaction

Urease

H2S

Indole

Sugar Fermentation Lactose  Dextrose   Glucose

Presumptive identity

 

FMH              +ve  cocci         -           +                  -              -                  +             -             -                    -           AG                    Staphlococcus sp

FMR               -ve rods            -          +                   -              -                  -              -             -                   AG       AG                     Esherichia sp

FMB                +ve cocci        -           +                  -               -                 +             -             -                   AG        AG        Staphylococcus sp

FMN               -ve rods           +          +                  +              +                 -             -            AG                AG        AG                   Enterobacter sp

FMJ                 -ve rods           -           -                   -               -                 +            -             -                    AG        AG                   Shigella sp

SOH (F) 308   -ve rods          -            -                   -               -                 +            -             -                    AG        AG                   Shigella sp         

UBTC C          -ve rods          -            +                  -               -                 -             -             -                     AG       AG                   Escherichia sp

SOH (E) 316   -ve rods         +            +                 +               -                 +            +            -                      AG       AG                  Proteus sp

SOH (B) 299   -ve rods         -             -                  -               +                 -             -            -                        -           AG                 Shigella sp         

SOH (A) D      +ve cocci       -            +                 -                -                  +           -            -                        -            AG                            Staphylococcus sp

 

Key: + = positive, - =negative

Figure 4.1: PCR AMPLICON OF SELECTED ISOLATES RESULTS

4.3 Antibiotic Susceptibility Profile of the Isolates

Table 4.3 shows the antibiotic susceptibility profile of the isolates. The isolates were susceptible to imipenem (100%), vancomycin (80%) and netilimicin (70%); whereas, they were resistant to ceftazidime (100%), oxacillin (100%), cefotaxime (100%), tetracycline (80%), ceftazidime/clavulanate (70%), cefotaxime/clavulanate (70%), ciprofloxacin (60%), gentamycin (50%), and ofloxacin (50%). The ten isolates exhibited high levels of MDR with each of them being resistant to at least five (5) antibiotics (Table 4.4). Escherichia coli strain JCM 1649 had the highest frequency of MDR with MAR index of 0.92; while Staphylococcus caprae strain ATCC 35538 (FMB) and Staphyloccocus sciurisubsp. rodentium strain GTC 844 (FMH) had the least rate of MDR with MAR indices of 0.42 (Table 4.4).

The partial sequences (16S rRNA) of the isolates 321have been deposited in the NCBI database and appropriate ascension numbers (as indicated on the table) obtained.

Table 4.4  Isolates’ identity using partial sequence analysis of 16S rRNA genes
S/N	ISOLATE CODE		SOURCE		GenBank Ascension Number	Isolate Identity		E Value	% Identity
1		FMB  (GLORY_16SF_1)	Wound swab (Female; 38 yrs)	MN545861		Staphylococcus caprae strain ATCC 35538 (MDR/ESBL producer)	0.0		99.75
2		FMJ (GLORY_16SF_2)	HVS (Female; 20 yrs)	MN540635		Shigellasonnei strain CECT 4887 (MDR)	0.0		99.24
3		FMN (GLORY_16SF_3)	HVS 36 female	MN545859		Enterobactercancerogenus strain LMG 2693 (MDR)	3e-147		93.50
4		FMR (GLORY_16SF_4)	Stool (Female; 2 yrs)	MN545860		Escherichiacoli strain JCM 1649 (MDR)	3e-162		95.57
5		SOH (A) D (GLORY_16SF_5)	HVS (Female; 28 yrs)	MN543049		Staphylococcus caprae strain ATCC 35538 (MDR)	0.0		99.75
6		SOH (F) 308 (GLORY_16SF_6)	Urine (Female; 36 yrs)	MN543639		Shigellaflexneri strain ATCC 29903 (MDR/ESBL Producer)	0.0		99.75
7		SOH (B) 299 (GLORY_16SF_7)	Urine  ( Male; 38 yrs)	MN543904		Shigellaflexneri strain ATCC 29903 (MDR)	0.0		99.75
8		SOH (E) 316 (GLORY_16SF_8)	Urine ( Female; 36 yrs)	MN544215		Proteusmirabilis strain ATCC 29906 (MDR)	0.0		97.72
9		FMH (GLORY_16SF_9)	Stool (Male; 2 yrs)	MN544271		Staphylococcussciuri subsp. rodentium strain GTC 844 (MDR/ESBL Producer)	0.0		99.49
10		UBTHC (GLORY_16SF_10)	Urine (Female; 26 yrs)	MN544280		Escherichiafergusonii ATCC 35469 (MDR/ESBL Producer)	4e-151		93.48

        Phylogenic tree showing comparative identity of Isolate Glory 16S_1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_3

                                                                                              

 

 

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_4

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_5

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_6

 

 

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_7

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_8

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_9

 

 

 

 

 

 

 

Phylogenic tree showing comparative identity of Isolate Glory 16SF_10

 

 

````````````````````````````

 

 

 

 

 

 

 

 

Orgs/Code

OX

CIP

GM

T

IMI

VA

NET       OFX        CAZ/ CV

CAZ

CTX/CV

CTX

MAR INDEX

SOH(A) D SOH(B) 299 FMB SOHF (308) FMN FMH UBTHC FMJ SOH(E) 316 FMR % resistance % intermediate % sensitivity

R R R R R R R R R R 100 0 0

R R I R I I R R S R 60 30 10

S S R R I I R I R R 50 10 40

R R R R R I R R S R 80 10 10

S S S S S S S S S S 0 0 100

S S S S S S S I S R 10 10 80

S S S I S S R S S R 20 10 70

R R S R R I S S S R 50 10 40

R R S S R R S R R R 70 0 30

R R R R R R R R R R 100 0 0

R R S S R R S R R R 70 0 30

R R R R R R R R R R 100 0 0

0.67 0.67 0.42 0.58 0.58 0.58 0.58 0.58 0.50 0.92

Table 4.5. Antibiotic susceptibility pattern of suspected ESBL isolates against selected antibiotics.

 

Key: OX: Oxacillin, CIP: ciprofloxacin, GM: gentamicin, IMI: imipenem, VA: vancomycin, OFX: ofloxacin, CAZ/CV: ceftazidime/clavulanate, CAZ: ceftazidime, CTX/CV: cefotaxime/clavulanate, CTX: cefotaxime, S: sensitive, I: moderately sensitive, R: resistant, MAR: multiple antibiotic resistance.

   5.0    DISCUSSION

Multidrug resistant (MDR) and extended spectrum beta lactamase (ESBL) producing organisms are among the most notable causes of infections globally, largely because of their resistance to several antibiotics (Doi et al., 2013; WHO, 2015).  This brings new demands to investigate the potential of multi drug resistant (MDR) bacterial strains and perform ESBL phenotyping on suspected isolates.

Urinary tract infection (UTI) is one of the most common widespread infections, mainly caused by ESBL Enterobacteriaceae, especially Escherichia coli, that are encountered by hospitalized and outpatients (Adwan et al., 2014). Normally, UTIs are treated with different classes of antibiotics such as β-lactams, β-lactam/ β-lactamase inhibitors, carbapenems, and fluoroquinolones (Aboumarzouk, 2014). However, recent data worldwide reveal that these uropathogens have become resistant to most conventional drugs (Kariuk et al., 2007). Enterobacteriaceae harboring ESBLs is a global problem with limited available treatment options (Lewis et al., 2007). ESBL-producing bacteria are related with infections that are consequences of bad clinical facilities, inappropriate antibacterial therapy, prolonged hospital stays, and greater hospital costs (Lewis et al., 2007). In the past years, there has been an increase in widespread dissemination of β-lactamase-mediated resistance with high significance in the prevalence of ESBL producing Enterobacteriaceae (Paterson, et al., 2004).

In the present study, MDR/ESBL producing isolates were prevalent in clinical samples obtained from affected hospitals. The observed prevalence in this study might be considered low (12.25%), when compared to that reported by Ogefere et al. (2015) from UBTH, Benin (44.3%). The observation was however within the range of ESBL prevalence rates (5-44%) reported by several other studies in Nigeria (Olonitola et al., 2007; Olowe and Aboderin, 2010; Yusha'u et al., 2010; Akujobi and Ewuru, 2010; Mohammed et al., 2016). 

Phenotypic identification of the suspected MDR/ESBL isolates revealed that the ESBL producers isolated from the clinical samples were both Gram negative and Gram-positive organisms. Several researchers have reported Gram positive and Gram-negative organisms as ESBL producers (Kehinde et al., 2004; Mehedi et al., 2013; El-rahaman and Elhag, 2015). Gram negative bacteria cause a significant number of infections in Nigerian hospitals and represent the majority of isolates obtained from both wound and urine samples in microbiology laboratories (Omoregie et al., 2010). The MDR/ESBL producing isolates reported in the current study: Enterobacter, Escherichia, Shigella, Staphylococcus and Proteus have been identified as MDR/ESBL producers in previous reports (Omoregie and Eghafona, 2009; Ogefere et al., 2015; Oli et al., 2017; Giwa et al., 2018).          Foster, (2017) and Walsh (2016) opined that both Staphylococcusaureus and members of the enterobacteriaceae family develop resistance to antibiotics simply by acquisition of determinants by horizontal gene transfer (HGT) of mobile genetic elements which evolve or by mutations that alter the drug binding sites on molecular targets and by increasing expression of endogenous efflux pumps. Thus the ESBL phenotype expressed by the Staphylococcus spp. in this study could have been occasioned by HGT from other organisms. This is a subject of further investigation in our laboratory.

Imipenem has been reported to be highly effective against multidrug resistant organisms and ESBL producers (Ogefere et al., 2015). This is consistent with findings in this study which showed a 100% susceptibility to imipenem. Other studies have reported same efficacy of the antibiotic against MDR organisms and ESBL producers (Gupta et al., 2006; Sasirekha, 2013). Carbapenems (including imipenem) are regarded as the antibiotic of choice and mainstay of treatment used against infections caused by ESBL producing/MDR organisms (Pitout et al., 2005; Ogefere et al., 2015). Vancomycin is a member of the class of reliable and critically available glycopeptide antibiotics which are highly effective against severe infections with β-lactam-resistant bacteria (Kang and Park, 2015). It is a drug of choice in the treatment of MDR organisms especially Staphylococcus spp(Laible et al., 2017). Panwalker et al. (1978) reported that netilmicin, an analog of gentamicin has a high antibacterial activity against many strains of the enterobacteriaceae family in agreement with the observation of this study. These results suggest that imipenem, vancomycin and netilimicin are effective drugs in the treatment of MDR/ESBL producing organisms within the study area. However, despite the good performance of vancomycin and netilmicin antibiotics against the MDR/ESBL producers observed in this study, some researchers have reported resistance to these antibiotics (Cetinkaya et al., 2000; Raut et al., 2015).

 

All MDR/ESBL producing organism were 100% resistant to oxacillin, ceftazidime and cefotaxime. This observation is in line with previous reports which suggest high rate of resistance to these antibiotics (Raut et al., 2015; Elrahaman and Elhag, 2015).  ESBL enzymes have been reported to confer resistance to all penicillins and cephalosporins (Cormican et al., 1996). Gentamicin, ofloxacin and ciprofloxacin assayed in this study were poorly active against ESBL producers at 40%, 10% and 40% respectively. The quinolones are increasingly becoming resistant due to their excessive use in the treatment of various infections resulting in high selective pressure, prevalent in an environment in which antibiotics are freely available without restrictions (Babalola and Lamikanra, 2002). Moreover, resistance to third generation cephalosporins as exhibited by ESBLs often coexists with resistance to other antibiotics (Iroha et al., 2008). Such associated resistance was also seen with gentamicin that showed low sensitivity in this study.

 

Molecular confirmation of the isolates revealed that some of the isolates were rarely associated with the sample sources for this study. The presence of MDR S. sonnei, S. flexineri, and Enteobacter cancerogenus in urine and vaginal swabs is interesting as there is sparse information on their clinical prevalence. Stoll (2006) and Wills and Robinson (2018) have reported that E,cancerogenus and Shigella species; (S. flexineri and S. sonnei) are rarely isolated from humans.  The analysis identified Escherichia coli strain JCM 1649 as the most resistant organism to the antibiotics used in this study with an MAR index of 0.92 against 0.2 reported by (Stephen and Kennedy, 2018). While Staphylococcus
caprae strain
ATCC 35538 was the most sensitive (0.41), which is in agreement with the findings of Ismailet al. (2015). The high prevalence of antibiotic resistance properties of E coli could be attributed to possession of multiple resistance genes in the bacterial genome that enable them resist all the antibiotics. This corroborates the findings of Kaplan, et al. (2005) who reported that MAR by E coli is usually associated with increased expression of multiple antibiotic resistance genes, including those coding for aminoglycoside resistance. This finding is quite worrisome as the isolation frequencies and emergence of multidrug resistant E. coli strains within the last two decades has gradually increased (Kumar et al., 2014). Antibiotic resistance mechanism via the overexpression of efflux pumps which has been reported by Chollet et al. (2002) and Schneiders et al. (2005) was responsible for multidrug resistance in E coli (Kumar et al., 2014). In clinical isolates of E. coli, a frame shift mutation in marR was responsible for the constitutive overexpression of marA and acrAB resulting in tigecycline resistance (Keeney et al., 2008).Olorunmola et al. (2013) reported the E. coli resistance to commonly used antibiotics together with their virulence properties in Ile-Ife, Nigeria.The isolates demonstrated a high and widespread resistance (51.1 % to 94.3 %) to all the antibiotics used except Nitrofurantoin (7.3 %). A total of 50 (36.5 %) of the isolates were resistant to 10 of the eleven antibiotics employed (Olorunmola et al., 2013). E coli causes a number of bacterial infections including cholecystitis, hemolytic uremic syndrome, cholangitis, urinary tract infection, pneumonia, neonatal meningitis and diarrhea and is often associated with increased mortality and morbidity especially among children in developing countries (Bhavsar and Krilov, 2015). Antimicrobial agents including fluoroquinolones and cephalosporins have been the mainstay of therapy in severe infections caused by E. coli but emerging reports of multidrug resistant strains from various parts of the world have suggested that their efficacy is in decline (Monique et al., 2016). In agreement with the observation of this study, various researchers have reported MDR E. coli strains of clinical origin in developing countries like Nepal , India, Sudan and  Nigeria (Mahato et al., 2004; Kumar et al., 2014; Elrahman and Elhag, 2015; Ogefere et al., 2015).

This study is significant as it validates and ascertains the degree of ESBL and multidrug resistance activities of bacterial isolates of clinical origin. This study provides further evidence that humans are important source of ESBL and MDR producing Enterobacteriaceae (S. sonnei,S. flexineri and Enterobacter cancerogenus). The data of this study underline the importance of a proper and conscious clinical surveillance and hygiene in order to curtail the spread of ESBL multidrug resistance bacteria in our health facilities globally.

 

5.1       CONCLUSION AND RECOMMENDATION

This study has found a considerable rate (12.25%) of ESBL producers in clinical samples obtained from three hospitals in Asaba, Nigeria. The multidrug resistant profile of the isolates against commonly used clinically relevant antibiotics were also quite high.  More worrisome is the emergence of Escherichia coli as the most resistant isolate giving the fact that the organism is the causative agent for several diseases of immense public health importance especially in Nigeria. This study also demonstrated that imipenem, vancomycin and netilmicin were effective drugs in the treatment of MDR/ESBL producing bacteria. The findings of this study call for the institution of an effective hospital-based infection prevention/control and antibiotic stewardship programs aimed at limiting the spread of MDR/ESBL producing bacteria from and within our health care facilities.

Also, further studies on the plasmid profile of the MDR/ESBL isolates should be performed to understand their mode of resistance.

 

5.2    CONTRIBUTION TO THIS FIELD OF STUDY

To the best of our knowledge, this is the first report of Enterobacter cancerogenus and Escherichia fergusonii in Nigeria and therefore will be an avenue for further research in this field of study.

 

REFERENCES

Aboumarzouk, O. M. (2014). “Extended Spectrum Beta-Lactamase Urinary Tract Infections”.             Urology Annals, 6(2):114-115.

Adwan, K., Jarrar, N., Abu-Hijleh, A., Adwan, G. and Awwad, E. (2014). “Molecular Characterization of Escherichia coli Isolates from Patients with Urinary Tract Infections         in Palestine,” Journal of Medical Microbiology, 63(2):229–234.

Akujobi,C.N and  Ewuru, C.P. (2010). Detection of Extended Spectrum Beta-Lactamases in Gram Negative Bacilli from Clinical Specimens in a Teaching Hospital in South Eastern Nigeria. Nigerian Medical Journal,4(51): 141-146.

Asensio, A., Oliver, A. and González-Diego, P. (2000). Outbreak of A Multiresistant Klebsiella pneumoniae Strain in an Intensive Care Unit: Antibiotic Use as Risk Factor for Colonization and Infection. Clinical and Infectious Diseases, 30(1): 55–60.

Atlas, R and Bartha, R. (1998). Microbial     Ecology     Fundamentals     and Applications.   4th   ed. Menlo Park, Ca.: Bemjammin/Cummings Publishing Company Inc.
Levinson,  W.,  Review  of  Medical Microbiology and Immunology. 13th ed. McGraw-Hill Education, USA.

 Babalola, O.O and Lamikanra, A. (2002). Pattern of Antibiotic Purchases in Community Pharmacies in South Western Nigeria. Journal of Social and Administrative Pharmacy, 19:33‑8.

Becker K., Heilmann C., Peters, G. (2014). Coagulase-Negative Staphylococci. Clinical Microbiology Review, 27:870–926.

Behme, R.J., McNabb, A., Shuttleworth, R., Colby, W.D. J. (1997).Human Isolates of Staphylococcus caprae: Association with Bone and Joint Infections. Clinical Microbiology, 35: 2537–2541.

Bhavsar, S and Krilov, L (2015). Escherichia coli Infections. Pediatr Rev. 36(4): 167-171

Bonomo, R.A and Rice, D. (1999). Mechanisms of Multidrug Resistance in Acinetobacter species and Pseudomonas aeruginosa. Clinical and Infectious Diseases, 43(2):S49–56.

Bonomo, R.A., Rudin, S.A. and Shlaes, D.M. (1997). Tazobactam is a Potent Inactivator of Selected Inhibitor-Resistant Class A Β-Lactamases. FEMS Microbiology Letters, 148(1):59-62.

Bradford, P.A. (2011). Extended-Spectrum Beta-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of this Important Resistance Threat. Clinical Microbiology Review, 14:933.

Carretto, E., Barbarini, D., Couto, I., De Vitis, D., Marone, P.,  Verhoef, J., De Lencastre, H., Brisses, S. (2005). Identification of Coagulase-Negative Styphylococci other than Staphylococcus Epidemidis by Automated Ribotyping. Clinical Microbiology and Infestation, 11(3): 177-184.

Castanheira M., Toleman M., Jones R., Schmidt F. and Walsh T. (2015). Molecular Characterization of A Beta-Lactamase Gene, Blagim-1, Encoding A New Subclass of Metallo-Beta-Lactamase. Antimicrobial Agents and Chemotherapy, 48: 4654–4661.

Cetinkaya, Y., Falk,P and Mayhall, C.G. (2000). Vancomycin Resistant Enterococci. Clinical microbiology Review, 13(4):686-707.

Chollet, R., Bollet, C., Chevalier, J., Mall´ea, M., Pag`es, J. and Davin-Regli, A. (2002). “Mar             Operon Involved in Multidrug Resistance of Enterobacter aerogenes,”Antimicrobial          Agents and Chemotherapy, 46(4):1093–1097.

Chukwuka EJ, Moemeke CD, Onyemaechi U, Nneka NR, Ejaita OA, Chukwuka GE and Nkechi AT, 2026. The impact of modern technological innovations on food security in Nigeria: A cutting-edge technology from an agropreneurship perspective. Agrobiological Records 23: 158-172. https://doi.org/10.47278/journal.abr/2026.014

Chukwuka, E. J., & Moemeke, C. D. (2026). The Application of Innovative Technologies in Science Teaching and Learning on the Academic Performance of Entrepreneurship Students. Journal for Studies in Management and Planning, 12(1), 138–154. https://doi.org/10.26643/jsmap/13

Chukwuka, E. J., Dibie, K. E. (2024). Strategic Role of Artificial Intelligence (AI) on Human Resource Management (HR) Employee Performance Evaluation Function. International Journal of Entrepreneurship and Business Innovation 7(2), 269-282. DOI: 10.52589/IJEBI-HET5STYK

Clinical Laboratory Standards Institute (2011). Performance Standards for Antimicrobial Susceptibility Testing: Twenty-first Informational Supplement. 31.

Cormican, M.G., Marshall, S.A. and Jones, R.N. (1996). Detection of Extended–Spectrum Β–Lactamase (ESBL)–Producing Strains by the E Test ESBL Screen. Journal of Clinical Microbiology, 34: 1880 – 1884.

Cosgrove, S.E. (2002). The Relationship between Antimicrobial Resistance and Patient Outcomes: Mortality, Length of Hospital Stay, and Health Care Costs. Clinical Infection Disease, 42: 82–89.

Cox, G. and Wright, G.D. (2013). Intrinsic Antibiotic Resistance: Mechanisms, Origins, Challenges and Solutions. International Journal of Medical Microbiology, 303:287–292.

Coyle, M.B. (2005). Manual of Antimicrobial Susceptibility Testing. American Society for Microbiology Press, Washington D.C. 25- 39. Pp

De Lencastre, H., Oliveira, D. and Tomasz, A. (2017). Antibiotic Resistant Staphylococcus aureus: a Paradigm of Adaptive Power. Current Opinion in Microbiology, 10(5):428-435.

Doi, Y., Park, Y. S. and Rivera, J. I. (2013). Community-Associated Extended-Spectrum Beta-Lactamase-Producing Escherichia coli Infection in the United States. Clinical Infectious Diseases, 56(5): 641–648.

Elrahaman, E.M and Elhag, W.I. (2015). Detection of Extended spectrum β-lactamase (ESBLs) Resistance among Wound Infection Pathogens in Khatoum State. Asian Journal of Research in Chemistry,3(6):161- 168.

Foster, T.J. (2017). Antibiotic Resitance in Staphyloccus Aureus. Current Status and Future Prospects.  Federation of European Microbiological Societies Microbiology review,14(3): 430-449.

Giwa, F.G., Ige, T.O. and Haruna, D.M. (2018). Extended-Spectrum Beta-Lactamase Production and Antimicrobial Susceptibility Pattern of Uropathogens in a Tertiary Hospital in                   Northwestern Nigeria. Annals of Tropical Pathology,9(1):11-16.

Goossens, H. (2009). Antibiotic Consumption and Link to Resistance. Clinical Microbiology and Infection, 15 (3):12–15.

Gorwitz, R.J. (2008). Understanding the Success of Methicillin-Resistant Staphylococcus aureus Strains Causing Epidemic Disease in the Community. Journal of Infectious Diseases, 197(2): 179–182.

Gowda, A., Pensiero, A.L. and Decker, C.D. (2018). Staphylococcus caprae: A Skin Commensal with Pathogenic Potential. Cureus, 10 (10): 1-6.

Gu, B., Pan, S., Zhuang, L.., Yu, R., Peng, Z., Qian, H., Wei, Y., Zhao, L. and Liu, G. (2012). Comparison of the Prevalence and Changing Resistance to Nalidixic Acid and Ciprofloxacin of Shigella between Europe-America and Asia-Africa from 1998 to 2009. International Journal of Antimicrobial Agents, 40(1):9-17.

Gupta, E., Mohanty, S., Sood, S., Dhawan, B., Das, B.K. and Kapil, A. (2006). Emerging Resistance to Carbapenems in a Tertiary Care Hospital in North India. Indian Journal of Medical Research, 124:95‑98.

Gupta, G., Tak, V. and Mathur, P. (2015). Detection of AmpC β Lactamases in Gram-Negative Bacteria. Journal of Laboratory Physicians,14(6):1–6.

Gupta, V. (2007). An Update on Newer Beta-Lactamases. Indian Journal of Medical Research, 126(5):417- 427.

Himps, S. D., Lockatell, C. V., Hebel, J. R., Johnson, D.  E. and Mobley1, L. T. (2008). Identification of Virulence Determinants in Uropathogenic Proteus mirabilis using Signature-Tagged Mutagenesis.  Journal of Medical Microbiology, 57: 17-21.

Hooper, D. (2005). Urinary Tract Agents: Nitrofurantoin and Methenamine. In: Mandell, G.L., Bennet, J.E., Dolin, R., Editors. Principles and Practice of Infectious Diseases. 6th ed. Philadelphia: Elsevier.p. 473‑478.

Hoque, M.M., Ahmed, M., Chowdhury, J.P., Nurunnobis, B. and Mahmood, S. (2012). Detection of Extended-Spectrum Β-Lactamases Producing Bacteria in Combined Military Hospital, Dhaka. Journal of Armed Forces Medical College,8(2):8-15.

Igbinosa, E.O. and Odjadjare, E.E. (2015). Antibiotics and Antibiotic Resistance Determinants: An Undesired Element in the Environment.  In: The Battle against Microbial Pathogens: Basic Science, Technological Advances and Educational Programs (A. Méndez-Vilas, Ed.Formatex research center, Spain. 858-866.

Iroha, I. R., Esimone, C. O. and Neumann, S. (2008). First Description of Escherichia coli Producing CTX-M-15- Extended Spectrum Beta Lactamase (ESBL) in Out-Patients from South Eastern Nigeria, Annals of  Clinical Microbiology, 11(19): 201-221.

Ismail, H., Bello, Y., Mustafa, H. and Adamu, A. (2015). Multidrug Resistance Pattern of             Staphylococcus Aureus Isolates in Maiduguri Metropolis.  Scientific Review,Vol.      1(2):16-20.

Jacobsen, S. M., Sticker, D. J., Mobley, H. L.  T. and Shirtliff, M.  E. (2008).  Complicated Catheter-Associated Urinary Tract Infections due to Escherichia coli and Proteus mirabilis.Clinical Microbiology Review,21 (1): 26-59.

Kang, H. and Park, Y. (2015). Glycopeptide Antibiotics: Structure and Mechanisms of Action.Journal of Bacteriology and Virology, 45(2);67-78.

Kariuki, S., Revathi, G. and Corkill, J.  (2007).   “Escherichia coli from Community-Acquired             Urinary Tract Infections Resistant to Fluoroquinolones and Extended-Spectrum Beta- Lactams.” Journal of Infection in Developing Countries, 1(3):257–262.

Kato, J., Mori, T. and Sugita, K. (2010).  Central Line-Associated Bacteremia Caused By Drug-Resistant Staphylococcus Caprae after Chemotherapy for Acute Myelogenous Leukemia. International Journal of Hematology, 91:912–913.

Keeney, D., Ruzin, A., Mcaleese, F., Murphy, E. and Bradford, A. (2008). “MarA-Mediated             Overexpression of the Acrab Efflux Pump Results in Decreased Susceptibility to         Tigecycline in Escherichia coli,” Journal of Antimicrobial Chemotherapy, 61(1):46–53.

Kehinde, A.O., Ademola, S.A., Okesola, A.O. and Oluwatosin, O.M. (2004). Pattern of Bacterial Pathogens in Burn Wound Infections in Ibadan, Nigeria. Annals of Burns fire disasters, 42:348-355.

Kimberlin, M., Jackson, M., Long, S. and Brady, D. (2015). Shigellosis. American Academy of Paediatrics. 30th ed.  Elk Grove Village, Califonia, USA.

Kluytmans, J., Edder, P., Schrenzel, J. and Harbarth, S. (2017). Extended-Spectrum β-lactamase-Producing Enterobacteriaceae in Hospital Food: a Risk Assessment.Infection Control and Hospital Epidemiology, 35:375-83.

Knothe, J., Iranpour, D., Hassanpour, M., Ansari, H., Tajbakhsh, S., Khamisipour, G. and Najafi, A. (1983). Phylogenetic groups of Escherichia coli Strains from Patients with Urinary Tract Infection in Iran Based on the New Clermont Phylotyping Method. Biomedical Research International,14(5): 44-62.

Knudsen, J.D and Andersen, S,E. (2014). A Multidisciplinary Intervention to Reduce Infections of ESBL- and AmpC-Producing, Gram-Negative Bacteria at a University Hospital. PLoS ONE9(1): 86-91

Kotloff, K., Blackwelder, W. and Nataro, J. (2013). Burden and Aetiology of Diarrhoeal Disease in Infants and Young Children in Developing Countries (The Global Enteric Multicenter Study, GEMS): A Prospective, Case-Control Study. Lancet, 12: 209-222.

Kotra, A., Karami, N., Helldal,L., Welinder-Olsson, C., Ahren, C and Moore,E.R. (2002). Sub-Typing Of Extended-Spectrum-Beta-Lactamase-Producing Isolates from A Nosocomial Outbreak: Application Of A 10-Loci Generic Escherichia Coli Multilocus Variable Number Tandem Repeat Analysis. PLoS One, 8:83-90.

Kumar, D., Singh, K. and Ali, M. (2014).Antimicrobial Susceptibility Profile of Extended Spectrum Β-Lactamase (ESBL) Producing Escherichia Coli from Various Clinical Samples.Infectious Disease Research and Treatment, 7:1-8.

Laible, B.R., Hellwig, T.R. and Hedge, D.D. (2017). Susceptibility of Staphylococcusaureus to Vancomycin: Analysis of Minimum Inhibitory Concentration in Two Tertiary Care Hospitals in Eastern South Dakota. S. D. Medicine, 64(3):91-95.

Levy, S. B. (2010). The Challenge of Antibiotic Resistance. Scientific America,278:46–53.

 

Lewis, J.S., Herrera, M., Wickes, B., Patterson, J.E. and Jorgensen, J.H. (2007). “First Report of the  Emergence of CTX-M-Type Extended-Spectrum Β-Lactamases (Esbls) as the Predominant ESBL Isolated in a U.S. Health Care System.” Antimicrobial Agents and Chemotherapy, 51(11): 4015–4021.

Livermore, D. M. and Brown, D. F. J (2001). Detection of _-lactamase Mediated Resistance. Journal of Antimicrobial Agents and Chemotherapy, 48(1):59–64.

Lowe, O.A and Aboderin, B.W. (2010). Detection of Extended Spectrum Beta Lactamase Producing Strains Of Escherichia coli And Klebsiella Species in a Tertiary Health Centre in Ogun State. International Journal of Tropical Medicine, 5:62-4.

Mahato,S. (2004). “Relationship of Sanitation Parameters with Microbial Diversity and Load in Raw Meat from the Outlets of the Metropolitan City Biratnagar, Nepal,” International Journal of Microbiology,19(4):10-17.

 Mansy, M. S. M. (2008). Genomic Fingerprinting Using Random Amplified Polymorphic DNA for   Discrimination   between Proteus mrabilis Strains. Egyptian Journal of Biotechnology, 9: 67-79.

Mehedi, H.M., Arongozeb, G., Muktadir, K. and Zakaria, A. (2013). Isolation and Identification of Different Bacteria from Different Types of Burn Wound Infections and Study Their Antimicrobial Sensitivity Pattern-IMPACT. International Journal of Research Natural and Social Science,1(3):125-132. 

Moemeka, C.D., Chukwuka, E.J. (2026). Effective Science Education for Technological Transformation and Entrepreneurial Digitization of Nigeria. International Journal of Multidisciplinary and Innovative Research 3(3), 168-179. https://doi.org/10.58806/ijmir.2026.v3i3n03

Mohammed, Y., Gadzama, G.B., Zailani, S.B. and Aboderin, A.O. (2016). Characterization of Extended-Spectrum Beta-Lactamase from Escherichia Coli and Klebsiella Species from North Eastern Nigeria. Journal of Clinical and Diagnostic Research, 10:07-10.

Monique, R., Bidell, A., Palchak, B., Mohr, B. and Thomas, P. (2016). Fluoroquinolone and Third-Generation-Cephalosporin Resistance among Hospitalized Patients with Urinary Tract Infections Due to Escherichia coli. Antimicrobial Agents and Chemotherapy, 60:3170–3173.

Murray, B.E, Mathewson, J.J., DuPont, H.L., Ericsson, C.D. and Reves, R.R. (2005). Emergence of Resistant Fecal Escherichia Coli in Travellers Not Taking Prophylactic Antimicrobial Agents. Antimicrobial Agents and Chemotherapy, 34:515–518.

Nahla, O.E., Yassine, H.M., Al Thani., Marwan, A.M., Ismail, A., Ibrahim, E., Alali, W. (2018). Prevalence Of Antibiotic Resistant Escherichia Coli Isolates From Fecal Samples of Food Handlers in Qatar. Antimicrobial Resistance and Infection Control, 7:78

Nathisuwan, S., Burgess, D.S. and Lewis, J.S. (2001). Extended Spectrum Beta‑Lactamases: Epidemiology, Detection and Treatment. Pharmacotherapy, 21:920‑928.

Nemeghaire, S., Agudin, A., FeBler, A., Hauschild, T., Schwarz, S. and Butaye, P. (2014). The Ecological Importance of the Staphylococcus Sciuri Species Group as a Reservoir for Resistance and Virulence Genes. Veterinary Microbiology, 171(3-4): 342-356.

Nikaido, H., Sugawara, E., Kojima, S. (2016). Klebsiella pneumoniae Major Porins Ompk35 and Ompk36 Allow More Efficient Diffusion of Beta-Lactams than their Escherichia coli Homologs Ompf and Ompc. Journal of Bacteriology, 198(23): 3200-3208.

Noor, R and Munna, M.S. (2015). “Emerging Diseases in Bangladesh: Current Microbiological Research”,Tzu Chinese Journal of Medicine, 27(2): 49-53.

Odjadjare, E.E., Igbinosa, E., Mordi, R., Igere, B., Igeleke,C.L and Okoh, A. (2012). Prevalence of Multiple Antibiotics Resistant (MAR) Pseudomonas Species in the Final Effluents of Three Municipal Wastewater Treatment Facilities in South Africa. International Journal of Environmental Research and Public Health,9(6):2092-2107.

Odjadjare, E.E., Igbinosa, E.O. (2017) Multi-drug Resistant Vibrio Species Isolated From Abattoir Effluents in Nigeria. Journal of Infection in Developing Countries, 11:373-378

Ogbolu, D.O., Daini, O.A., Ogunledun, A., Alli, A.O. and Webber, M.A. (2013). High Levels of Multidrug Resistance in Clinical Isolates of Gram Negative Pathogens from Nigeria. International Journal of Antimicrobial Agents, 37(1): 62 – 66.

Ogefere, H.O., Aigbiremwen, P.A. and Omoregie, R. (2015). Extended-Spectrum Beta-Lactamase (ESBL)-Producing Gram-Negative Isolates from Urine and Wound Specimens in a Tertiary Health Facility in Southern Nigeria. Tropical Journal of Pharmacology Research, 14:1089-94.  

Oli, A.N., Eze, D.E., Gugu, T.N. and Ezebor, I. (2017). Multi-Antibiotic Resistant Extended-Spectrum Beta-Lactamase Producing Bacteria Pose A Challenge to the Effective Treatment of Wound and Skin Infections. Pan African. Journal, 27:66-71.

Olonitola, O.S., Olayinka, A.T., Inabo, H.I. and Shuaibu, A.M. (2007). Production of Extended Spectrum Beta Lactamases of Urinary Isolates of Escherichia coli and Klebsiella pneumoniae in Ahmadu Bello University Teaching Hospital, Zaria, Nigeria. International Journal of Biology and Chemical Science, 2(1):181‑5.

Olorunmola, F., Kolawole, D. and Lamikanra, A. (2013). Antibiotic Resistance and Virulence Properties in Escherichia coli Strains from Cases of Urinary Tract Infections. African Journal of Infectious Diseases, 7(1): 1 – 7

Olowe, O.A. and Aboderin, B.W. (2010). Detection Of Extended Spectrum Beta Lactamase Producing Strains Of Escherichia Coli And Klebsiella Species in a Tertiary Health Centre in Ogun State. International Journal of Tropical Medicine, 5:62‑4.

Omoregie, R., Igbarumah, I.O., Egbe, C.A., Ogefere, H.O. and Ogbogu, P.I. (2010). Prevalence of Extended Spectrum Β– Lactamase Among Gram-Negative Bacteria Isolated from Surgical Wound and Blood Stream Infections in Benin City, Nigeria. Medical Laboratory Science, 64: 74 – 76.

 Pakyz, A.L., MacDougall, C. and Oinonen, M. (2008). l. Trends in Antibacterial Use in Us Academic Health Centers: 2002 to 2006. Archives of Internal Medicine, 168:2254–2260.

Paterson D. L. and Bonomo R. A. (2005). “Extended-Spectrum 𝛽- Lactamases: A Clinical Update,” Clinical Microbiology Review, 18(4): 657–686.

 

Paterson, D.L., Ko, W. and Von, A. (2004). “Antibiotic Therapy for Klebsiella pneumoniae Bacteremia: Implications of Production of Extended-Spectrum Β-Lactamases,” Clinical Infectious Diseases,39(1) 31–37.

Perez,F.J and Hanson, N.D. (2002). Detection Of Plasmid-Mediated Ampc Beta-Lactamase Genes in Clinical Isolates by using Multiplex PCR. Journal of Clinical Microbiology, 40(6):2153-62.

Pfaller, M.A and Segreti, J. (2006). Overview of the Epidemiological Profile and Laboratory Detection of Extended-Spectrum Β-Lactamases. Clinical Infectious Diseases, 42(4):153-163.

Pfeiffer, T., Schuster, S. and Bonhoeffer, S. (2010). Cooperation and Competition in the Evolution of ATP-Producing Pathways. Science, 292:504–507.

Philippon, A., Arlet, G. and Jacoby, G.A. (2002). Plasmid-determined AmpC-type Betalactamases. Antimicrobial Agents and Chemotherapy, 46:1–11.

Pitout, J. D. and Laupland, K. B. (2008). Extended-Spectrum 𝛽-Lactamase-Producing Enterobacteriaceae: An Emerging Public Health Concern, Lancet Infectious Diseases, 8(3): 59–166.

Pitout, J. D., Le, P. G., Moore, K. L., Church, D. L. and Gregson, D. B. (2010). Detection of AmpC β-Lactamases in Escherichia coli, Klebsiella spp., Salmonella spp. and Proteus mirabilis in a Regional Clinical Microbiology Laboratory. Clinical Microbiology and Infection,16: 165–170.

Pitout, J.D., Nordmann, P., Laupland, K.B., Poirel, L. (2005). Emergence of EnterobacteriaceaeProducing Extended‑Spectrum Β-Lactamases (Esbls) In the Community. Journal of Antimicrobial and Chemotherapy, 56:52‑59.

Raji, M.A., Wafaa, J., Omoh, O and Rotimi, V. (2013). Point-Surveillance of Antibiotic Resistance in EnterobacteriaceaeIsolates from Patients in a Lagos Teaching Hospital, Nigeria. Journal of  infection and  Public Health,6(6):431-437.

Raut, S., Gokhale, S. and Adihari, B. (2015). Prevalence of Extended Spectrum Beta Lactames among Esherichiacoli And Klebsiella Spp Isolates in Manipal Teaching Hospital, Pokhara, Nepal. Journal of Microbiology and Infectious Diseases, 5(2):69-75.

Ruppe, P.L., Woerther, E. and Barbier, F. (2015). Mechanisms of Antimicrobial Resistance in Gram-Negative Bacilli. Annals of Intensive Care, 5: 21.

Sahraoui, H.L., El Hassan, B., Quasmaoui, A., Charof, R. and Mennane, Z. (2016). Detection Methods Of Enterobacteriaceae Producing Extended Spectrum Betalactamase. International Journal of Innovation and Applied Studies,15(2):232-239.

 

Sasirekha, B. (2013). Prevalence of ESBL, AMPC Beta‑Lactamases and MRSA among Uropathogens and its Antibiogram. Experimental and Clinical Science Journal, 12:81‑8.

Savini, V., Cataviello, C. and Talia, M. (2007). Multidrug-Resistant Esherichia fergusonii: a Case of Acute Cystitis. Journal of Clinical Microbiology, 6: 45-50.

Schneiders, T., Amyes, S. and Levy, S. (2003). “Role of AcrR and ramA in Fluoroquinolone Resistance in Clinical Klebsiella Pneumoniae isolates from Singapore,” Antimicrobial Agents and Chemotherapy,47(9):2831–2837.

Schroeder, G.N. and Hilbi, H. (2008). Molecular Pathogenesis of Shigella spp.: Controlling Host Cell Signaling, Invasion, and Death by Type III Secretion. Clinical Microbiology Review, 21:134-156.

Seng, P., Barbe, M., Pinelli, P., Gouriet, F., Drancourt, M., Minebois A., Cellier, M., Lenchiche, C., Asencio, G., Lavigne, J., Sotto, A. and Stein, A. (2014). Staphylococcus caprae Bone and Joint Infections: A Re-Emerging Infection? Clinical Microbiology and Infection, 20 (12) 01052-8.

 Steward, C.D., Rasheed, J.K., Hubert, S.K., Biddle, J.W., Raney, P.M. and Anderson, G.J. (2001). Characterization of Clinical Isolates of Klebsiella pneumoniae from 19 Laboratories using the National Committee for Clinical Laboratory Standards Extended-Spectrum Beta-Lactamase Detection Methods. Journal of Clinical Microbiology, 39:2864–72.

Traa, C., Walker, C., Munos, M. and Black, R. (2010). Antibiotics for the Treatment of Dysentery in Children. International Journal of Epidemiology, 39(1):70-4.

Tumbarello, M., Spanu, T., Di Bidino, R., Ruggeri, M., Trecarichi, E.M. and De Pascale, G. (2010). Costs of Bloodstream Infections Caused by Escherichia coli influence of Extended-Spectrum-Β-Lactamase Production and Inadequate Initial Antibiotic Therapy. Antimicrobial Agents and Chemotherapy; 54:4085–91.

Turner, P.J. (2015). Extended-Spectrum Beta-Lactamases. Clinical and Infectious Diseases, 41: 273-275.

Williamson, R., Collatz E. and Gutmann, L. (2013). Mechanisms of Action of Beta-Lactam Antibiotics and Mechanisms of Non-Enzymatic Resistance. Presse Medicine, 20:2282–2289.

 

World Health Organization (WHO). (2014). Antimicrobial Resistance: Global Report on Surveillance. Geneva. Switzerland.Pp 23.

World Health Organization (WHO). (2015). Global Action Plan on Antimicrobial Resistance. Geneva, Switzerland. 93-97.

Yong, D., Lim, Y.S. and Yum, J.H. (2009). Nosocomial Outbreak of Pediatric Gastroenteritis Caused By CTX-M-14-Type Extended-Spectrum Β-Lactamase-Producing Salmonella Enterica   Serovar London. Journal of Clinical Microbiology, 43(7), 3519–3521.

Yusha’u, M.M., Aliyu, H.M., Kumurya, A.S. and Suleiman, L. (2010). Prevalence of Extended Spectrum Beta‑Lactamases amongEnterobacteriaceaein Murtala Muhammad Specialist Hospital, Kano, Nigeria. Bayero Journal of Pure and Applied Sciences, 3:169‑77.

Yushau, M., Olonitola, S. O. and Aliyu, B. S. (2011). Prevalence of Extended – Spectrum Beta Lactamases (Esbls) Among Members of the Enterobacteriaceae Isolates Obtained from Mohammed Abdullahi Wase Specialist Hospital, Kano, Nigeria. International Journal of Pure and Applied Science,1(3):42–48.

Yusuf, I., Arzai, A,H., Haruna,M., Sharif, A. and Getso, M. (2014). Detection of Multi Drug Resistant Bacteria in Major Hospitals in Kano, North-West, Nigeria. Brazilian Journal of Microbiology, 45(3):791-798.

Chukwuka, E. J., & Moemeke, C. D. (2026). The Strategic Effect of Entrepreneurial Education on Nigerian Economic Development. International Journal for Social Studies, 12(2), 48–59. https://doi.org/10.26643/ijss/9

Chukwuka, E.J, Nwaka, R.N., Idoye C., Azimi, S. A (2026). Effective Internal Control System as a Measure against Business Failures in Asaba, Delta State, Nigeria. International Journal of Advanced Research in Multidisciplinary Studies (Ijarms), 5(2), 569-580.

Chukwuka, E.J & Nwaka, R.N. (2026). The Nexus of Creative Destruction in Entrepreneurship and Nigeria's Economic Development. Jalingo Journal of Social and Management Sciences, 7(1), 245-264.

Chukwuka, E.J., & Igweh, K. F., I., & Nwaka, R.N. (2026). Assessing the contribution of small and medium-scale enterprises to economic development in Nigeria. International Journal of Development and Management Review, 21(1), 191–216. Retrieved from https://www.ajol.info/index.php/ijdmr/article/view/321832

Chukwuka, E. J., & Amahi, F. U. (2026). Assessing the Modern Employee Management Strategies for Optimum Organizational Productivity in Nigeria. Journal for Studies in Management and Planning, 12(2), 1–7. https://doi.org/10.26643/jsmap/7